LM-PCR

Ligation-mediated PCR (LM-PCR) was performed as described previously with modification (Brinkman et al., 2018). HFFs transduced with lentivirus expressing SaCas9 and sgRNA were infected with HSV-1 at an MOI of 3 and harvested at the indicated time post infection. Total DNA was purified, and a primer extension reaction was performed using a primer (0.1 µM) complementing downstream of UL30-5 site (UL30 63610 R: CAGAAGTTGTCGCACAGGTA) to convert all the cleaved DNA (500 ng total) into blunt ended dsDNA toward to UL30-5 target site using Q5 2x master mix (NEB, final 50 µL, 35 s at 98°C, 15 s at 50°C, and 30 s at 72°C). The blunt end dsDNA was purified using PCRClean DX beads (Aline Biosciences) at 1:1.2 ratio following manufacturer’s protocol. Modified NEB adaptor primers (NEB adaptor top: GATCGGAAGAGCACACGT and NEB blunt adaptor bottom: GACTGGAGTTCAGACGTGTGCTCTTCCGATC) were incubated at 95°C for 5 min and annealed over 20 min by decreasing temperature gradually to 25°C. The annealed adaptor (50 nM) was ligated to the blunt end of dsDNA (30 µL out of 35 µL elution) with T4 ligase (NEB) in 50 µL reaction at 16°C overnight. PCR was performed using a primer complementing the adaptor (NEB PCR primer: GCGACGTGTGCTCTTCCGATC) and UL30 63610 R primer using Q5 2x mater mix following manufacturer’s protocol. Control PCR products were generated using a primer complementary to a site near the UL30-5 target site (UL30-5 cut 63181 F: TCACCGTCT TTCACGTGTA) and UL30 63610 R primer.