RNA extraction and quantification of miR-34a by stem-loop reverse transcription-quantiative polymerase chain reaction (RT-qPCR)

All tissue samples were homogenized in TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), and the total RNA was isolated according to the manufacturer's instructions. A total of 1 µg RNA was reverse transcribed into first strand cDNA using the PrimeScript RT Reagent kit (RR037A; Takara Biotechnology Co., Ltd., Dalian, China) in a 20 µl reaction mixture containing the following: 5X PrimeScript buffer (4 µl), PrimeScript RT Enzyme Mix I (1 µl), Oligo Dt Primer (1 µl), stem-loop R (1 µl) and total RNA (1 µg), made up to 20 µl with RNase-free dH₂O. The RT reaction was performed as follows: 37°C for 15 min, 85°C for 5 sec, then terminated at 4°C. RNA concentration was determined by absorption at 260 nm. Quantification of miR-34a by stem-loop RT-qPCR was performed as described previously (2). Primers were as follows: miR-34a, FACACTCCAGCTGGGTGGCAGTGTCTTAGCT, stem-loop RCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAACCAG and general reverse TGGTGTCGTGGAGTCG; U6, FCTCGCTTCGGCAGCACAandRAACGCTTCACGAATTTGCGT.