Generation of atoh8 knockout zebrafish and vascular phenotype screening

Generation of atoh8 knockout fish lines using the CRISPR/Cas9 technique was performed as described previously (54). Briefly, guide RNA (gRNA) was designed to target the first exon of atoh8 gene (GGGAGCGCGCGGAGTCGCCT; see Fig. 3B), with 5’-terminal modification (GG) for transcription with T7 polymerase during gRNA synthesis. Each founder (F₀) was outcrossed with Tg(fli1:EGFP). Heterozygous F₁ adults with fli1:EGFP were screened, and 2 mutant lines designated atoh8^uu3111 and atoh8^uu3112 were confirmed (Fig. 3B and 3C). The heterozygous F₁ fishes were incrossed and the resulting progenies (F₂) were analyzed blindly and genotyped afterward. For detailed analysis of the vascular phenotype, we utilized the VAST BioImager platform (30) (Union Biometrica, Boston, MA, USA) according to the manufacturer’s instructions. ISV formation was quantified in the trunk region posterior to the end of yolk extension.