Sequence recovery

RNA was extracted from ∼2×10⁶ cells grown in 24-well plates using Tri-Reagent (Sigma-Aldrich) and was reverse transcribed with ProtoScriptII Reverse transcriptase (Neb) using random nonamers, according to the manufacturer's instructions. Variable regions were amplified by PCR using Q5 DNA polymerase (Neb) by means of forward primer EF1aNotI_F (CCATTTCAGGTGTCGTGAGC) and reverse primers CG-revseq-1 (GTTCGG GGAAGTAGTCCTTG) for VH and Intron-rev-1 (GTGGATGTCAGTAAGACCAATAGGTGCC) for VL. Cycling conditions were 98°C/30sec -> 30x (98°C/20sec, 58°C/20sec, 72°C/45sec) -> 72°C/5min -> hold@ 4°C. PCR products were purified by column purification (Macherey-Nagel), digested and again purified by agarose-gel purification. Recovered variable region fragments were assembled with human IgH-γ 1 and IgL-κ constant regions in the expression vector pCB14b. To determine VH and VL sequences, several bacterial clones per library clone were sequenced (Microsynth AG) using the pCB14b sequencing primer CMVseq2 (GCAGTGTAGTCTGAGCAGTAC). Variable region sequences were compared to designed library sequences using Geneious R8 Software (Biomatters).