HPV-16 siRNA transfection and E6/E7 rescue experiments

EW Erin Isaacson Wechsler
ST Sharof Tugizov
RH Rossana Herrera
MC Maria Da Costa
JP Joel M. Palefsky
request Request a Protocol
ask Ask a question
Favorite

AKC2 cells were plated at 1.5×105 cells in 6-well plates and were transfected with 30 pmol of siRNA oligonucleotides using RNAi MAX reagent (Invitrogen). The following siRNA oligonucleotides were used for transfection: Control siRNA-A (Santa Cruz Biotechnologies) HPV-16 E6 (Santa Cruz Biotechnologies), HPV-16 E7 (Santa Cruz Biotechnologies), HPV-16 E5 target sequence: AATGGTATTACTATTGTGGATAA (Eurofins MWG Operon) and HPV-16 E5 target sequence #2 CAACATTACTGGCGTGCTTTT (Dharmacon). RNA expression was measured 72 h post-siRNA transfection. To perform E6/E7 rescue experiments 1.5×105 AKC2 cells were first transfected with 1 µg of pB-actin E6/7 expression plasmid (a kind gift from Karl Munger) or the promoter-less pGL3 basic control plasmid (Promega) using Lipofectamine LTX and Plus reagent (Invitrogen). Then, 24h later the AKC2 cultures were transfected again with 30 pmol of the appropriate siRNA using RNAi MAX reagent (Invitrogen). cDNA or protein expression was measured 72 h post-plasmid transfection.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A