Chromatin immunoprecipitation

ChIP experiments were carried out as previously described in detail (Lee et al., 2016) with minor changes. Briefly, infected cell monolayers were fixed in 1% formaldehyde (Sigma-Aldrich) at 37°C for 15 min. Fixation was quenched with glycine at a final concentration of 125 mM for 3 min. Cells were washed 3 times in ice cold PBS supplemented with 1 mM phenylmethanesulfonylfluoride (PMSF), collected in PBS + PMSF, and pelleted at 2000 rpm for 5 min at 4°C. Cell pellets were re-suspended in 1 mL lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1), transferred to 15 mL polystyrene tubes and sonicated at 4°C in a Diagenode Biorupter on high setting for 9 cycles of 5 min each (30 s ON, 30 s OFF). An aliquot of recovered chromatin was used for each IP reaction in 1 ml IP dilution buffer (150 mM NaCl, 10 mM Na₂HPO₄, 2 mM EDTA, 1.1% Triton, 0.1% SDS). An aliquot of a no antibody IP reaction was retained as 10% input sample. IPs were performed with 2.5 μg (6.0 μg for ATRX ab) of ChIP grade antibody (see Antibodies) per reaction and incubated overnight at 4°C. 20 μl of MagnaChIP protein A magnetic beads (Millipore) were added for 2.5–3 hr at 4°C with rotation, washed 3 times with a cold low-salt buffer (150 mM NaCl, 20 mM Tris·HCl, pH 8.1, 2 mM EDTA, 1% Triton X-100, and 0.1% SDS, 1 mM PMSF) and 3 times with cold LiCl wash buffer (50 mM HEPES pH 7.5, 250 mM lithium chloride, 1 mM EDTA, 1% NP-40, 0.7% sodium deoxycholate, 1 mM PMSF), and washed once with cold Tris-EDTA buffer (10 mM Tris-HCl, pH 8, 1 mM EDTA). DNA-protein complexes were eluted in 100 μl of elution buffer (1% SDS, 0.1 M NaHCO₃) at 65°C for 20 min. Protein-DNA crosslinks were reversed by adding NaCl (0.2 M final concentration) and incubating at 95°C for 30 min followed by 1 hr RNase A (Ambion) treatment at 37°C and Proteinase K treatment (Roche) at 45°C for 2 hr. DNA was purified using a QIAquick PCR purification kit (Qiagen) end eluted twice with 50 μl buffer EB for a final volume of 100 μl.

Quantitative-PCR was performed to quantify DNA using Fast SYBR Green reagents (ThermoFisher) on a StepOnePlus from Applied Biosystems (ThermoFisher). Oligos for qPCR reactions are as follows:

FWD ACCCAGCCAGCGTATCCACC

REV ACACCATAAGTACGTGGC

FWD GAGACCGGGGTTGGGGAATGAATC

REV CCCCGGGGGTTGTCTGTGAAGG

FWD CAGGCGCCCAATACGACCAAAATC

REV TTCGACAGTCAGTCAGCCGCATCTTCTT