Analysis of antigenome replication during hPIV2 Rluc minireplicon assay

Quantification of antigenome was performed by quantitative real-time RT-PCR (qRT-PCR) using RNA sample immunoprecipitated by anti-NP mAb. At 48 h post-transfection, cells were lysed in lysis buffer (20 mM Tris-Cl [pH 8.0], 150 mM NaCl, 10% Glycerol and 1% Triton X-100) containing cOmplete Protease Inhibitor (Roche). The supernatants obtained by centrifugation were incubated with a mAb against hPIV2 NP (159-1) (Nishio et al. 1999) and protein A-Sepharose. The immunoprecipitated sample was subjected to RNA extraction using Isogen (Nippon Gene). To increase the efficiency of RNA extraction, Dr. GenTLE Precipitation Carrier (Takara) was used according to the manufacturer's instruction. The cDNA synthesis was carried out by the PrimeScript RT Reagent Kit (Takara) with specific primer for antigenome RNA (5′-ACCAAGGGGAAAATCAATATGTT-3′). For trailer–trailer copyback-like antigenome, an alternative primer (5′-CATTGTTGTTATTGTTCATTTTTG-3′) was used. qRT-PCR was performed by using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) using primers for Rluc gene (F: ATAACTGGTCCGCAGTGGTG, R: TAAGAAGAGGCCGCGTTACC).