qPCR for viral load quantification

Challenged mice were bled from the submandibular vein at day 4 post infection and sera was isolated. RNA from sera was extracted using the PureLink Viral RNA/DNA Mini Kit according to manufacturer’s instructions (Invitrogen). Real time RT-qPCR was performed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB). It was run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna kit cycling conditions (55 °C for 10 min, 95 °C for 1 min, and 40 cycles of 95 °C for 10 s and 60 °C for 1 min). Results were compared to a standard curve created using ZIKV RNA extracted from a known quantity of infectious virus. Unamplified samples were set at the limit of detection (100 FFU equivalent/mL). The following primer probe set was used: 1183 F: 50-CCACCAATGTTCTCTTGCAGACATATTG-30; 1268 R: 50-TTCGGACAGCCGTTGTCCAACACAAG-30; and probes (1213 F): 5′FAM/AGCCTACCTTGACAAGCAGTC/BHQ1–3′²².