Generation of mutant cells

Mutant cells were generated by the CRISPR/Cas9 system from Streptococcus pyogenes (Ran et al., 2013), using the HPRT co-targeting strategy (Liao et al., 2015) as previously described (Harayama and Riezman, 2017). Target sequences (listed below) were selected based on high specificity and efficacy scores predicted by the CRISPOR algorithm (Haeussler et al., 2016), and the corresponding pairs of oligo DNA were synthesized (Microsynth AG, Balgach, St. Gallen, Switzerland). Plasmids were constructed by assembling annealed oligo DNA pairs and plasmids in single tube reactions using FastDigest Bpi I (Thermo Fisher Scientific) and quick ligase (New England Biolabs, Ipswich, MA, USA) in quick ligase buffer. Three cycles of restriction at 37 and ligation at 25 were repeated (5 min for each step), followed by Bpi I restriction for one hour to remove empty vectors. pX330 plasmids (Ran et al., 2013) were used for assembly, except for HPRT guide RNA, for which pUC-U6-sg plasmid (Harayama and Riezman, 2017) was used. Plasmids were transformed into chemical competent STBL3 bacterial cells (Thermo Fisher Scientific, Waltham, MA, USA), sequence-verified by Sanger sequencing (Fasteris SA, Plan-les-Ouates, Geneva, Switzerland), and purified using GenElute Plasmid Miniprep kit (Sigma-Aldrich, St. Louis, MO, USA) followed by endotoxin removal by isothermal Triton X-114 extraction (Ma et al., 2012). Plasmids (98 ng total of plasmids for target(s) and 2 ng plasmid for HPRT) were reverse transfected into HeLa MZ cells using Lipofectamine 3000 (Thermo Fisher Scientific) in a 96 well plate, cell culture areas were scaled up before reaching over confluency, and selected with 6 μg/mL 6-thioguanine (Sigma-Aldrich) 5 days post-transfection. After one week of selection, the resistance against 6-thioguanine caused by the mutations in the co-targeted HPRT gene led to enrichment for mutations in the target genes (Liao et al., 2015). To evaluate mutation rates, individual loci were analyzed by PCR direct sequencing (using primers listed below) followed by TIDE (tracking indels by deconvolution) analysis (Brinkman et al., 2014). PCR reactions were peformed using ExTaq polymerase (TAKARA Clonthech, Otsu, Shiga, Japan).

• Guide RNA sequences for genome editing

–SPHK1: CTGGTGCTGCTGAACCCGCG

–SPHK2: TGAGTGGGATGGCATCGTCA

–HPRT: GTAGCCCTCTGTGTGCTCAA

• Primers for genome DNA analysis

–SPHK1: TATCCCTCACGAGGCCAGAA, TAGAGGAGCACTGACGGGAA

–SPHK2: AACCACGTGCTTCCCATGAT, GGGGTTGGGGAAAGAGACAG