Animals

Animal protocols were conducted in accordance with guidelines set forth by the Cincinnati Children's Hospital Medical Center Institutional Animal Care and Use Committee and the National Institutes of Health. All mice used in this study were maintained on an outbred background. Dlx1-Cre mice (RRID:MMRRC_036076-UCD) were obtained from GENSAT (Gong et al., 2007; Gerfen et al., 2013) and were genotyped with the following primers: Dlx1-Cre5 (5′-ATGCAAGAGAGCCGACCAAT-3′) and Dlx1-Cre3 (5′-GGCAAACGGACAGAAGCATT-3′). Sp8-GFP BAC (RRID:MMRRC_034608-UCD) mice were obtained from GENSAT (Gong et al., 2003) and genotyped with the primers GFP57-5′ (5′-AGCAAAGACCCCAACGAGAAGC-3′) and GFP57-3′ (5′-CCAACAACAGATGGCTGGCAAC-3′). Tshz1^GFP mice (Ragancokova et al., 2014) were genotyped with either of the following two primer pairs: Tshz1^GFP5 (5′-GTTGAGGTGGCCTTGTAAGC-3′) and Tshz1^GFP-GFP3 (5′-AAGTCGTGCTGCTTCATGTG-3′) or EGFP5 (5′-GACGTAAACGGCCACAAGTTC) and EGFP3 (5′-CTTCAGCTCGATGCGGTTCA-3′). The Tshz1^Flox allele (Ragancokova et al., 2014) was genotyped with the following primers: Tshz1^RA5 (ATCAGGGGTCTTGGTGTCCT) and Tshz1^RA-WT3 (5′-AGTTCAGTCCTTCCGTGGTG-3′). The Tshz1^Flox mice were crossed with EIIa-cre mice (The Jackson Laboratory; RRID:IMSR_JAX:003724) to generate the recombined null allele Tshz1^RA and genotyped with the following primers: Tshz1^RA5 (5′-ATCAGGGGTCTTGGTGTCCT-3′) and Tshz1^RA-RA3 (5′-TCCCCACAGCCTCTAACCATA-3′). The Tshz1^WT allele was genotyped with the primer set: Tshz1^GFP5: (5′-GTTGAGGTGGCCTTGTAAGC-3′) and Tshz1^GFP-WT3 (5′-ATTCGCTCTCCTGAATGTCC-3′). The Gsx2^RA allele (RRID:MGI:4412087) (Waclaw et al., 2009) was genotyped with the primers: Gsx2^RA5: (5′-ACGGAGATTCCACTGCCTCT-3′) and Gsx2^RA3 (5′-CTCCCAGACACAGATCCAGAC-3′). The Gsx2^WT allele was genotyped with the primers Gsx2–1437 (5′-GCATCCACCCCAAATCTCAGTC-3′) and Gsx2-Int5b (5′-CCACGGAGATTCCACTGCC-3′). Foxp2^S321X mice (RRID:MGI:3795717) were genotyped as described previously (Gaub et al., 2010).

For staging of embryos, the day of vaginal plug detection was considered embryonic day 0.5 (E0.5). Brains were collected at the time point indicated in the figures. Brains of embryos E15.5 and older were dissected from the skull before fixation, whereas brains of embryos E14.5 and younger were fixed with the forming skull intact. Tissues were fixed in 4% PFA overnight. Brains at P3 and younger were cryoprotected in 30% sucrose, and 12 μm sections were collected with a cryostat and stored at −20°C. Brains that were P12 and older were cryoprotected in 12% sucrose and sectioned on a sliding microtome at 35 μm. Sections were stored at −20°C in a solution of 30% glycerol/30% ethylene glycol in PBS.