4.2. Genetic Analysis

For each group, 10 sample blocks, sections of 10 µm were cut from each specimen with a new sterile blade and outer sections were discarded. Four or five scrolls from serial sections were placed in each tube (Eppendorf AG, Hamburg, Germany) for DNA extraction protocols.

We extracted the samples with QIAamp DNA Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions with this modification: the pellet was digested with a tissue lysis (ATL) buffer (Qiagen, Valencia, CA, USA) and proteinase K overnight.

We built primers for M278T SNP, allele A/G, rs 3906956, with Primer3web version 4.0.0 (ELIXIR, Tartu, Estonia). All primers were synthesized (Eurofins Genomics, Ebersberg, Bayern, Germany): AQPEX4shortFw 5′ ≥ 3′ AAAGAAGCCTTCAGCAAAGC; AQPEX4shortRw 5′ ≥ 3′ GGTCAACGTCAATCACATGC. Polymerase chain reaction (PCR) was carried out using 50-µL volume samples in a PCR thermocycler MasterCycler (Eppendorf AG, Hamburg, Germany). The PCR conditions for the 35 cycles were denaturation 95 °C for 30 s, annealing 55 °C for 30 s, and extension 72 °C for 1 min. Each sample contained 0.1 mg genomic DNA, 10 pmol of each primer, 125 mM deoxyribonucleoside triphosphate, 5 mM tris (hydroxymethyl) aminomethane (Tris) HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, and 1U Taq polymerase (Applied Biosystems, Foster City, CA, USA). Amplified DNA fragments were subjected to direct cycle sequence analysis using the Taq dye-deoxy terminator method with reverse primer (Applied Biosystems, Foster City, CA, USA) and an ABI PRISM 3100 Genetic Analyzer sequencer (Applied Biosystems, Foster City, CA, USA).