Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

RT-MLPA and RT-PCR analysis

FW Felix M. Wensveen
ES Erik Slinger
MA Martijn HA van Attekum
RB Robert Brink
EE Eric Eldering
request Request a Protocol
ask Ask a question
Favorite

Total RNA was extracted using the trizol isolation method (Invitrogen). mRNA levels of apoptosis genes were analyzed with the Mouse RT-MLPA kit (MRC-Holland)33 according to the manufacturer’s instructions. cDNA was generated using oligodeoxythymidine (oligo dT) and Superscript II Reverse Transcriptase (Invitrogen). Analysis of RNA transcripts were amplified by polymerase chain reaction (PCR) using the primer-pair TGGACATACAAGCAGCCTGG/TTTTCCAGGGACTC TTGCTGG (CD268). 18S was used as internal control (TCAAGAACGAAAGTCGGAGG/GGACATCTAAGG GCATCACA).

Copyright and License information:  ©2016, The Author(s)
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A