CRISPR-Cas9 screen

Lentiviral sgRNA plasmid libraries were generated using the human GeCKO-V2 sgRNA library (Addgene, #1000000049). The GeCKO-V2 library is composed of two sub-libraries (sub-library A and sub-library B). Each sub-library contains three unique sgRNA per gene and was independently packed into lentiviral libraries. The titer of lentiviral libraries was calculated as colony-forming units (CFU) per mL. The cell representation was 500, so each sgRNA on average is distributed into 500 cells. The multiplicity of infection (MOI) was 0.2. Polybrene (8 μg/mL, Santa Cruz, sc-134220) was also added to the medium to increase viral transduction efficiency. Cells were cultured in virus-containing medium for 2 d. Infected cells were selected with Puromycin (5 μg/mL, Thermo Scientific, A1113830); 3.3 × 10⁷ (for sub-library A) or 2.9 × 10⁷ (for sub-library B) cells were either saved as Round 0 (R0) samples, or seeded onto four 15-cm culture dishes and exposed to toxins. The survival cells were reseeded and cultured with normal medium without toxins until about 70% confluence. Cells were then subjected to the next round of selection. The remaining cells were harvested. The genomic DNA was extracted using a commercial kit (Qiagen, 13323, Gaithersburg, MD). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGP-1_F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) and lentiGP-3_R (ATGAATACTGCCATTTGTCTCAAGATCTAGTTACGC). NGS was performed by a commercial vendor (Genewiz, Illumina MiSeq, South Plainfield, NJ).