MTHFR genotyping

In order to DNA extraction, blood samples were collected into K3-EDTA-treated tube from both patients and controls, and were stored at -20°C. Total genomic DNA was extracted from peripheral blood leukocytes and was dissolved in sterile TBE buffer. The variant MTHFR C677T was genotyped by using PCR-RFLP analysis. The PCR primers were synthesized by primer 3 software and their sequences were as follows: Forward, 5’-CCTGACTGTCATCCCTATTGGC–3′ and reverse 5’- GGAGCTTATGGGCTCTCCTG–3′. Conditions for PCR amplification were 12.5 μl commercially available PCR premix (AccuPower PCR PremiX; BIONEER, Daejeon, Korea) containing (dNTP, TaqDNA polymerase, MgCl2, buffer), 2.0 μl (20 pmol/μl) forward and reverse primers, 2.0 μl (50 ng/μl) template DNA, and 6.5 μl sterile nuclease free water. The thermal cycling conditions were as follows: Initial denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 60 s, annealing at 53°C for 45 s, and extension at 72°C for 60 seconds, with a final extension of 5 min at 72°C. The PCR amplified products were scored in 248-bp in a mixture reaction consisting of: PCR products (10 μl), 10 × buffer (2 μl), 10 units HinfI (New England Bio labs, USA) restriction enzyme, and sterile nuclease free water (18 μl). The reaction mixture was kept overnight at 37°C for 1-16 h. The fragments were separated by electrophoresis on 3% agarose gel, stained with ethidium bromide and results were recorded with photographs of gels in UV light. The C677T substation introduces a new HinfI restriction site which results in the digestion of the 248-bp PCR product into 100 and 148-bp fragments. After electrophoresis of digested DNA fragments, homozygous C allele was represented by a DNA band sized at 248, whereas homozygous T allele was represented by a DNA band sized at 100 and 148-bp and heterozygotes sized at 248, 100 and 148-bp [Figure 1].

Representative example of MTHFR C677T polymorphism products by PCR-RFLP on agarose gel electrophoresis. Lane 1 shows 100-bp DNA Ladder; Lane 2 shows Non-template control; lanes 3, 5, 6, 7 and 12, show heterozygote CT genotype (248,148 and 100-bp); lanes 4, 13,14,15,16, 17, and 18, show wild type CC genotype (248-bp); lanes 8,9,10 and 11 show mutant TT genotype (148 and 100-bp)