Two PTPRS-specific siRNAs were obtained from Qiagen: PTPRS_5 siRNA (SI02759288 Qiagen, target sequence: CAGGACATTCTCTCTGCACAA); PTPRS_7 siRNA (SI03056284 Qiagen, target sequence: ATGGCGTGCCCGAATACCCAA).
Scrambled siRNAs from Qiagen (SI03650325) and Origene (SR30004) were used as controls. Transfections were performed at 20–30% cell confluency using the RNAiMAX Lipofectamine (Life Tech) according to the provided protocol using 30 nM of siRNA.
Copyright and License information: The Author(s) ©2018 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this
article to respond.