siRNA Transfection

TD Thomas B. Davis
MY Mingli Yang
MS Michael J. Schell
HW Heiman Wang
LM Le Ma
WP W. Jack Pledger
TY Timothy J. Yeatman
request Request a Protocol
ask Ask a question
Favorite

Two PTPRS-specific siRNAs were obtained from Qiagen: PTPRS_5 siRNA (SI02759288 Qiagen, target sequence: CAGGACATTCTCTCTGCACAA); PTPRS_7 siRNA (SI03056284 Qiagen, target sequence: ATGGCGTGCCCGAATACCCAA).

Scrambled siRNAs from Qiagen (SI03650325) and Origene (SR30004) were used as controls. Transfections were performed at 20–30% cell confluency using the RNAiMAX Lipofectamine (Life Tech) according to the provided protocol using 30 nM of siRNA.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A