RNA ligase mediated rapid amplification of complementary DNA ends (RLM-RACE) PCR

The MpRSL1 transcript cleavage product was identified by carrying out a RLM-RACE PCR as described in Llave et al. (2011). In short, RNA oligonucleotide adaptor (CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA) was first ligated to 5’ ends of total RNA extracted from 15 day old wild type gemmae. The RNA was reverse transcribed into cDNA using Protoscript II reverse transcriptase (New England Biolabs) in combination with a gene specific primer GSP-RSL1 (TCGTTGGAAGGCCAATAGTC). PCR was then carried out using primer ASP-F (CGACTGGAGCACGAGGACACTGA) that anneals onto the reverse transcribed RNA adaptor and MpRSL1 specific primer nested GSP-RSL1 1 (GCCTTTTCAAGCATGGTGAC). The PCR reaction was diluted 1:100. One ul of the diluted PCR product was used as a template for a second nested PCR, which was carried out using primers nested ASP-F (GGACACTGACATGGACTGAAGGAGTA) and nested GSP-RSL1 2 (CTCTGAGGATCGTTCGCACT). The resulting PCR products were gel purified, cloned into pGEM-T vector (Promega) and transformed into E. coli. The miRNA cleavage site was identified by sequencing plasmids extracted from 12 colonies.