G-CSF and shLDHA Co-Expression Vectors

G-CSF fragment with CMV promoter was cloned from G-CSF expression plasmid (MR225697, Origene) using KOD Xtreme hot start DNA polymerase (EMD Millipore). The GFP with CMV promoter in pGIPZ plasmid was cut off from shRNA (shLDHA and Scramble) expression plasmids (GE Dharmacon) with Xbaǀ and NotI (New England Biolabs) and replaced by G-CSF fragment with CMV promoter using T4 DNA Ligase (New England Biolabs). The following primers were used to clone G-CSF fragment: CTAGtctagatagttat taatagtaatcaattacggggtc and TTTTCCTTTTgcggccgcCTAGGCCAAGTGGTGCAGAGCA. G-CSF-pGIPZ plasmid was packaged with psPAX2 and pMD2.G plasmids in HEK293T cells to produce G-CSF expressing lentivurs.