RNA Extraction and qRT-PCR Analysis

Total cellular RNA was extracted from the cultured chondrocytes, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA was stored at −80°C. Reverse transcription was performed using 1.0 μg total RNA and a miRNA cDNA kit and HiFiScript cDNA kit (CWBIO, Beijing, China), which were used to investigate the expression of miRNA and HOXA1, respectively. Amplification reactions were conducted in 20-μL reaction volumes containing amplification primers and UltraSYBR Mixture (with ROX) (CWBIO) detected by an ABI 7500 Sequencing Detection System (Applied Biosystems, Foster City, CA, USA). 1-μL volume cDNA and 1-μL volume primer (Sangon Biotech, Shanghai, China) were used in each amplification reaction. The following cycling conditions were used: 40 cycles of denaturation at 95°C for 5 s and amplification at 60°C for 24 s. All reactions were conducted in triplicate and normalized using the miRNA housekeeping gene U6 or mRNA housekeeping gene β-actin. Primer sequences were as follows: human HOXA1 (forward: 5′-CGGCTTCCTGTGCTAAGTCT-3′ and reverse: 5′-TAGCCCAGCCAAATACACGG-3′), mouse Hoxa1 (forward: 5′-CCAGAGAGCTGGGTTCGTAG-3′ and reverse: 5′- GAACCATGGTGAATGTGCTG-3′), human BCL6 (forward: 5′-CCCATGTGTCTTCAGCTTTCT-3′ and reverse: 5′-CTCCTCAGTGGCAGGTTGTT-3′), mouse Bcl6 (forward: 5′-TGAGGGGTTTTGCATCCTCC-3′ and reverse: 5′-TCACGGGGAGGTTTAAGTGC-3′), human USF2 (forward: 5′-AATGGAGGACAGACAGGAACAC-3′ and reverse: 5′-TTTACTCGCTCCCGTCTTGC-3′), mouse Usf2 (forward: 5′-CCGGACACACCCCTATTCTC-3′ and reverse: 5′-TGCTCCTGTCTTGCTGTTGT-3′), human NCOR2 (forward: 5′-GCACTCATGGGTGGCGG-3′ and reverse: 5′-ATCAGGGGGTTGTAGGGGAA-3′), mouse Ncor2 (forward: 5′-GATCCCTCTGGAAGCAGCAG-3′ and reverse: 5′-GCTGCGAGGTGATGTAGTCA-3′), human β-actin (forward: AGCGAGCATCCCCCAAAGTT and reverse: GGGCACGAAGGCTCATCATT), mouse β-actin (forward: 5′-CCTCTATGCCAACACAGT-3′ and reverse: 5′-AGCCACCAATCCACACAG-3′), U6 (forward: 5′-CTCGCTTCGGCAGCACA-3′ and reverse 5′-AACGCTTCACGAATTTGCGT-3′), miR-10a-5p (forward: 5′-CGCTACCCTGTAGATCCGAATTTGTG-3′), miR-486-5p (forward: 5′-TCCTGTACTGAGCTGCCCC-3′), miR-4326 (forward: 5′-CGTGTTCCTCTGTCTCCCAGAC-3′), miR-30d-5p (forward: 5′-CGTGTAAACATCCCCGACTGGAAG-3′), miR-505-3p (forward: 5′-CCGTCAACACTTGCTGGTTTCCT-3′), miR-455-3p (forward: 5′-CGGCAGTCCATGGGCATATACAC-3′), universal miRNA reverse (reverse: 5′-GTGCAGGGTCCGAGGT-3′).