Yeast RNA isolation and Q-PCR

Yeast for RNA isolation were grown the same way as for lacZ assay but for the final day the whole volume was used. RNA was prepared by extraction with hot acidic phenol [25] and then treated with TURBO DNase (Ambion). Reverse transcription was carried out using a High-Capacity RNA-to-cDNA kit (Applied Biosystems) and Q-PCR was performed using a SensiFAST SYBR Hi-ROX kit (Bioline). We used 2 pairs of primers, first for lacZ as gene of interest (qlacZ_F GAAAGCTGGCTACAGGAAG; qlacZ_R GCAGCAACGAGACGTCA) and second for URA marker as reference gene (qURA3_F GGATGTTCGTACCACCAAGG; qURA3_R TGTCTGCCCATTCTGCTATT).