HDM asthma model.

To induce allergic lung inflammation, mice were sensitized on days 0, 1, and 2 and challenged on days 14, 15, 18, and 19 with 25 µg HDM extract (Greer, Lenoir, NC) or sterile saline intranasally. Before intranasal administration of HDM, all mice were anesthetized with isoflurane. BALB/c mice were treated with kininogen antisense oligonucleotide (KNG ASO; sequence GGCTATGAACTCAATAACAT) or control antisense oligonucleotide (Ctrl ASO; sequence CCTTCCCTGAAGGTTCCTCC) by subcutaneous injection twice weekly (40 mg/kg per injection) starting immediately after the sensitization phase (15). Mice were euthanized 24 h after the last challenge. In all experiments, citrate blood was collected from the vena cava inferior (4:1 vol/vol), and bronchoalveolar lavage (BAL) was collected by airway lumen lavage with 2 × 0.5 ml PBS containing 10 mM EDTA, 10 mM benzamidine, and 0.2 mg/ml soybean trypsin inhibitor as described (42). Cell counts were determined for each BAL sample in a hemocytometer (Beckman Coulter, Fullerton, CA), and cell differentiation was made by flow cytometric analysis. To obtain single cells, the flushed lungs were mechanically minced followed by digestion in RPMI with 5% FCS, 1% penicillin-streptomycin, Liberase TM, and DNAse at 37°C for 30 min. After 30 min of incubation, cells were dissociated by aspiration through a 19-gauge needle. Erythrocytes were lysed with sterile lysis buffer (Qiagen, Hilden, Germany). In a separate experiment, the unflushed lung was collected for pathology examination. To determine kng1 mRNA expression the liver was homogenized, and a sample was taken for RNA isolation.