Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Quantitative RT-PCR

JH Judith Hagenbuchner
SS Sabine Scholl-Buergi
DK Daniela Karall
MA Michael J. Ausserlechner
request Request a Protocol
ask Ask a question
Favorite

To quantify HADHA mRNA expression levels in retrovirally infected cells we designed real-time RT-PCR assays, using GAPDH as reference gene. Total RNA was isolated from 1 × 106 cells using Tri Reagent (Sigma-Aldrich, Vienna, Austria) according to the manufacturer’s instructions. Complementary DNA was synthesized from 1 µg of total RNA using the RevertAidTM First Strand H minus cDNA Synthesis Kit (Thermo Scientific, Sankt Leon-Rot, Germany). The oligonucleotides to amplify cDNA fragments were HADHA_RT_fwd (GCCCATGATGTCTGAAGTCATCC) and HADHA_RT_rev (CGCTACATCCACACCAACTTCATC) synthesized by Microsynth AG (Balgach, Switzerland). After normalization on GAPDH expression, regulation was calculated between ectopic HADHA-expressing cells and controls. Controls are set as 100% expression.

Copyright and License information: The Author(s) ©2018
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A