Lentivector transduction and CRISPR/Cas9-mediated genome editing.

Genome editing using lentivector-mediated delivery of CRISPR/Cas9 components was performed generally as described previously (41, 117). Briefly, 20-nucleotide guide RNA (gRNA) sequences targeting protein-coding regions were inserted into the lentiCRISPRv2 vector (AddGene 52961). These sequences were as follows. TRIF, CCTAGCGCCTTCGACATTCT; IFNAR, AAACACTTCTTCATGGTATG; IRF3, GAGGTGACAGCCTTCTACCG; STING, CCCGTGTCCCAGGGGTCACG; IPS-1, AGTACTTCATTGCGGCACTG. Sequence verification of genomic disruption for each cell line is presented in Fig.  8. Lentivirus was made by transfecting specific lentiCRISPRv2 plasmid along with packaging plasmid (psPAX2; AddGene 12260) and vesicular stomatitis virus G protein pseudotyping plasmid (pMD2.G; Addgene 12259) into Lenti-X 293T cells (Clontech) using Lipofectamine-LTX (Life Technologies, Inc.). Medium was harvested at 48 h and 72 h posttransfection, centrifuged (3,000 × g for 10 min), and filtered through a 0.45-μm filter to remove cell debris. Subconfluent target cells were exposed to lentivirus for 8 h in the presence of 5 μg/ml Polybrene. After the cells reached confluence, cultures were split into DMEM plus 10% FCS containing 3 μg/ml puromycin. Transduced cells were passaged in the presence of puromycin for 7 to 10 days before protein knockout was examined by immunoblotting. Cells were next serially diluted twice in 96-well plates to obtain oligoclonal lines purified for gene deletion. Sanger sequence verification of genomic disruption for each cell line is presented in Fig. S8. Protein knockout was additionally verified functionally by measuring phenotypic responsiveness to appropriate stimuli.

CRISPR/Cas9-mediated disruption of coding regions. The Sanger sequencing electropherograms show genomic regions near gRNA targeting sites of the indicated protein coding region along with corresponding gRNA sequences. Download FIG S8, PDF file, 0.3 MB.