ScFv-Fc fusion protein construction

KK Katja Klausz
MC Michael Cieker
CK Christian Kellner
HO Hans-Heinrich Oberg
DK Dieter Kabelitz
TV Thomas Valerius
RB Renate Burger
MG Martin Gramatzki
MP Matthias Peipp
request Request a Protocol
ask Ask a question
Favorite

To allow scFv fusion and cloning into the pSec-IgG1-Fc-prot-eng vector [65], the scFv sequence was amplified using primers LMB3 forward (5’ CAATTTCACACAGGAAACAGCTATGAC 3’) and NotI PspOMI reverse (5’ TTCGATCGGGCCCCCTGCGGCCGCCCGTTTGATTTCCACC 3’). PCR was performed with Pwo DNA Polymerase. The PCR product was extracted from agarose gel with NucleoSpin Gel and PCR Clean-Up kit (Machery-Nagel, Dueren, Germany). Vector and PCR product were digested with SfiI/NotI and SfiI/PspOMI (NEB, Ipswich, MA, USA), respectively, and cloned by using standard procedures. The amino acids exchanged in the Fc domain (S239D/I332E/A330L; ref. 15) enhance FcR binding and considerably reduce C1q binding of the resulting Fc-engineered scFv-Fc fusion protein TP15-Fc. The 4D5 scFv (anti-HER2) was used to design the control molecule 4D5-Fc [66]. Both fusion proteins contained a 6xHis-tag for purification and detection. The correct sequences of the final constructs were verified by Sanger sequencing.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A