Quantitative real‐time PCR

RNA was purified from A549 and MOLM13 cells using TRIzol (Invitrogen) and RNeasy mini kit (cat no 74104), respectively. First‐strand cDNA was generated using 100–200 ng of total RNA and oligo(dT) primers with the Superscript III reverse transcription kit (Invitrogen), and Omniscript RT kit (cat no 205113) was used for cDNA synthesis from MOLM13 cells. Quantitative RT–PCR was performed using TaqMan^® Gene Expression Master Mix (Applied Biosystems) or SYBR^® Green PCR Master Mix (Applied Biosystems) on an ABI Prism 7900HT system and StepOnePlus Real‐Time PCR system (Applied Biosystems). We used TaqMan^® assays to assess the knockdown effect for RPS6 (Hs01058685_g1), RPL26 (Hs00864008_m1), RPL13 (Hs00744303_s1), RPL21 (Hs03003806_g1), RPL29 (Hs00426490_g1), RPL14 (Hs03004339_g1), RPSA (Hs00347791_s1), and RPS12 (Hs04184906_g1) using ACTB (ABI #401846) as control, and P21 (Hs00355782_m1), NOXA (Hs00560402_m1), PUMA (Hs00248075_m1), BAX (Hs00180269_m1) were assessed using GAPDH (Hs02758991_g1) as endogenous control for MOLM13 cells. Quantitative PCR for P21 and ACTB was performed using SYBR^® Green PCR Master Mix (Applied Biosystems) and the following primers: P21 forward 5′‐GCTCTGCTGCAGGGGACAGC‐3′; P21 reverse 5′‐GCCGCCGTTTTCGACCCTGA‐3′; ACTB forward: 5′‐AGCGAGCATCCCCCAAAGTT‐3′; and ACTB forward: 5′‐GGGCACGAAGGCTCATCATT‐3′ for A549 cells.