Generation of transgenic plants

In all plasmids except pPZK111 the substitutions/deletions were introduced into the genomic ERECTA-RLUC sequence by overlap extension PCR using pESH427 as a template (Karve et al., 2011). The amplified fragments were digested with PstI, inserted into pESH427, and sequenced. The constructs carry the endogenous ERECTA promoter and the 35S terminator. The pPZK111 was generated by overlap extension PCR using pKUT196 as a template (Godiard et al., 2003). The amplified fragment was digested with PstI, inserted into pKUT196, and sequenced. This construct carries the endogenous ERECTA promoter and terminator. The backbone of all plasmids is the vector pPZP222. The plasmids were introduced into Agrobacterium tumefaciens strain GV3101/pMP90 by electroporation, and into Arabidopsis er-105 and er-105 erl1-2/+ erl2-1 plants by vacuum infiltration. The transgenic plants were selected based on gentamicin resistance and the number of rescued lines has been quantified based on general plant morphology (Supplementary Tables S1 and S2). The er-105 erl1-2 erl2-1 mutants were selected based on kanamycin resistance and the homozygous status of the erl1-2 mutation was confirmed by PCR with the primers erl1g3659 (GAGCTTGGACATATAATC), erl1g4411.rc (CCGGAGAGATTGTTGAAGG), and JL202 (CATTTTATAATAACGCTGCGGACATCTAC). In addition, for transgenic lines transformed with pPZK102, pPZK110, and pPZK111 constructs, the homozygous status of the erl1-2 mutation was confirmed by analysis of kanamycin resistance in the progeny. The quantitative phenotypic analysis of er erl1 erl2 plants transformed with the described constructs has been done in T3 generation once their genetic status was established.