Nascent RNA

To label RNA synthesis B cell cultures stimulated for 12 hours, labeled with 1 mM 5-ethynyl uridine (EU) for 30 minutes at 37°C, washed once in cold PBS and attached to glass slides coated with Cell-Tak (BD Biosciences) and fixed with 4% formaldehyde in PBS for 15 minutes. Permeabilization was carried out in 0.5% Triton X-100 in PBS for 15 minutes at RT and staining was done with the Click-iT RNA Alexa Fluor 594 Imaging kit according with the manufacturer's specifications. After Click-it, immunofluorescent staining was performed against γ-H2AX; after 30 minutes in blocking solution of 1% bovine serum albumin (BSA) in PBS with 0.05% Tween-20, slides were incubated with anti-phospho-Histone H2A.X (Ser139) at 1/10,000 in blocking solution for 1 hour at RT, followed by 3 washes in PBS with 0.05% Tween-20 for 5 minutes, secondary antibody goat anti-mouse IgG1 Alexa 488 at 1/10,000 in blocking solution of 1% bovine serum albumin (BSA) in PBS with 0.05% Tween-20 1 hour at RT and 3 washes in PBS with 0.05% Tween-20 for 5 minutes. DNA was counterstained with DAPI and slides were mounted using Vectashield (Vectorlabs). Imaging of γ-H2AX and EU-RNA intensity was performed using a wide-field epi-fluorescence Zeiss Axio Observer Z1 microscope equipped with a plan-apochromat ×63 (numerical aperture 1.4), motorized stage and Zeiss AxioCam CCD (charge-coupled device) camera. Images were acquired and processed using Zeiss Zen imaging software with the same acquisition parameters and imaging analyses were performed in 4 images per condition using ImageJ, (version 1.51m9, Analyze particle utility (Schneider et al., 2012). Data was analyzed using Prism (v.7 GraphPad). DRB (D-ribofuranosylbenzimidazole) (150 µM) or Triptolide (3 µM) was added to 90 minutes prior to EU labeling, and etoposide was present in the medium 5 minutes before and during the EU labeling (30 minutes).

For Nascent RNA-seq, B cell cultures stimulated for 12 hours and 4 million were labeled with 0.5 mM 5-ethynyl uridine (EU) for 30 minutes. Etoposide and DRB or Triptolide was added as indicated above. Total RNA extraction was performed using TRIzol (Ambion) and 1 µg was rRNA depleted using the NEBNext rRNA Depletion kit (human/mouse/rat) (New England Biosciences), prior to biotinylation by the Click-it reaction (Click-iT Nascent RNA Capture Kit, ThermoFisher {"type":"entrez-nucleotide","attrs":{"text":"C10365","term_id":"1535436","term_text":"C10365"}}C10365) using manofacture’s specification. First-strand cDNA synthesis of the captured nascent RNA was done using SuperScript VILO cDNA synthesis kit (Invitrogen), following AMPure XP purification (1.8X) and elution in 20 µl second-strand cDNA was synthesized with 0.6 mM dNTPs in the presence of 2 units of RNase H (Invitrogen) and 20 units of E. coli DNA polymerase I (Invitrogen) in a total volume of 30 µl for 2.5 hours at 16°C. Double stranded cDNA was cleaned using 1.8X Agencourt AMPure XP beads and eluted in 20 µl of EB that was used for end-repair. End-repair was performed in 50 µl of T4 ligase reaction buffer, 0.4 µM of dNTPs, 3 units of T4 DNA polymerase (NEB), 9 units of T4 Polynucleotide Kinase (NEB) units 1 U of Klenow fragment (NEB) at 24°C for 30 minutes in a ThermoMixer C at 400 rpm. End-repair reaction was cleaned using 1.8X Agencourt AMPure XP beads and eluted in 15 µl of EB that was used for A-tailing reaction in 30 µl of NEBNext dA-Tailing reaction buffer (NEB) with 7.5 U of Klenow fragment exo- (NEB) at 37°C for 30 minutes. The 30 µl of the A-tailing reaction were mixed with Quick Ligase buffer 2X (NEB), 3,000 U of Quick ligase and 5 nM of annealed adapter (Illumina truncated adapter) in a volume of 75 µl and incubated at 25°C for 20 minutes. The adapter was prepared by annealing the following HPLC oligos: 5’-Phos/GATCGGAAGAGCACACGTCT-3’and 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3’ (*phosphorothioate bond). Ligation was stopped adding 50mM of EDTA and cleaned with 1.8X Agencourt AMPure XP beads and eluted in 15ul of EB that was used for PCR amplification in a 50 15 µl reaction with 10 µM primers 5'-CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGT GCTCTTCCGATC*T-3' and 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCC GATC*T-3' * represents a phosphothiorate bond and NNNNNN a Truseq index sequence, and 2X Kapa HiFi HotStart Ready mix (Kapa Biosciences). The temperature settings during the PCR amplification were 45 s at 98 C followed by 15 cycles of 15 s at 98°C, 30 s at 63°C, 30 s at 72°C and a final 5 min extension at 72°C. PCR reactions were cleaned with Agencourt AMPure XP beads (Beckman Coulter), run on a 2% agarose gel and a smear 200–500bp was cut and gel purify using QIAquick Gel Extraction Kit (Qiagen). Library concentration was determined with KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems). Sequencing was performed on the Illumina Nextseq500 (75bp single end reads). Alternatively, for the triptolide experiment strand specific nascent-RNA libraries were generated by using in the second-strand synthesis reaction 1.2 mM of dUTP instead of 0.6 mM of dTTP, and the elution of the ligation reaction was treated with 0.5 units of Uracil-DNA glycosylase (Thermofisher) for 15 minutes at 37°C before the PCR.