Quantification of XBP1 splicing by quantitative PCR

HEK293 cells were treated with tunicamycin (5 μg/ml) and either trazodone, DBM (both 20 μM) or DMSO for 6 h. Total RNA was extracted with the mirVana^™ RNA/miRNA isolation kit (Ambion Inc.). RNA samples were reverse-transcribed with ImProm-II^™ reverse transcriptase (Promega) by priming with oligo(dT). Quantitative PCR was carried out at 95°C for an initial 3 min followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 65°C for 15 s and extension at 72°C for 30 s using SYBR® Green supermix and StepOnePlus^™ thermocycler (Applied Biosystems). Spliced XBP1 was detected using primers: forward 5'TGCTGAGTCCGCAGCAGGTG3' and reverse 5'GCTGGCAGGCTCTGGGGAAG3' and compared to the β-actin reference gene (forward 5’CCGATCCACACGGAGTACTTG3’ and reverse 5’GGCACCCAGCACAATGAAG3’).