Bisulfite RNA sequencing

Bisulfite RNA sequencing was performed to identify the methylation site (m5C) within an RNA fragment, as previously described. Briefly, 1 μg in vitro methylated p21 3′UTR fragment (methylated by NSUN2 by using cold SAM (Sigma)) or RNA isolated from cells was dissolved in 10 μl of RNase-free water and mixed with 42.5 μl of 5 M sodium bisulfite (Epitect) and 17.5 μl DNA protection buffer (Epitect), incubated in 70°C for 5 min and 60 °C for 60 min, repeating for 3–5 cycles. Samples were desalted by using Micro Bio-spin6 columns and then de-sulfonated by 1 M Tris (pH 9.0, 1/1, V/V) at 37°C for 1 h, followed by ethanol precipitation. The bisulfite-converted fragments (0.2 μg) were reverse-transcribed by RevertAid First-Strand cDNA Synthesis Kit (Thermo) using primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTTAACCTTC CTACCATTCC and subjected to PCR analysis by using primer pairs CCAAGCTTCTAATACGACTCACTATAGGGAGAGTTTGTTGGGAATGGGGCCTGGACTGTTTT and CTTAACCTTCCTACCATTCCTACAAGTAAAGTCACTAAGAATCATT. To test the m5C formation in the endogenous p21 mRNA, The bisulfite-converted cellular RNA were reverse-transcribed by RevertAid First Strand cDNA Synthesis Kit (Thermo) using primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTATATTCA and subjected to PCR by using primer pairs GGTTTTTGTTTTTTTATTTAGATTGT and GCAGGGTCCGAGGTATTC. The PCR products were inserted into the pGEM-T Easy Vector System (Promega). The plasmids purified from single clones were sequenced, the sequences aligned with the corresponding p21 mRNA sequence and the cytosines retained were considered to be methylated.