In vitro pUL89 nuclease ELISA.

The 60-bp ssDNA (5′-TAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCAC) was labeled with a DIG tag at the 5′ end, and its complementary ssDNA (5′-TCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGA) was labeled with biotin at the 5′ end. Equal moles of ssDNAs were mixed and annealed to obtain the 60-bp dsDNA. For the standard reaction, purified pUL89-C (final concentration, 1 μM) in reaction buffer (3 mM MnCl₂, 30 mM Tris [pH 8], and 50 mM NaCl) was preincubated with the compound in DMSO or DMSO alone for 15 min. The reaction was started by the addition of dsDNA (final concentration, 10 nM), and the mixture was incubated for 15 min to 1 h at 37°C. The reaction was terminated by adding EDTA (final concentration, 30 mM) to the mixture. The samples were transferred to streptavidin-coated plates (Pierce Biotechnology, Rockford, IL), incubated with gentle shaking at room temperature for 30 min, and washed three times with 200 μl of wash buffer (25 mM Tris, 150 mM NaCl, 0.1% bovine serum albumin [BSA], and 0.05% Tween 20 [pH 7.2]). One hundred microliters of the anti-DIG-alkaline phosphatase (AP) conjugate (Roche Applied Sciences, Germany) was added to each well for 30 min at room temperature, washed three times with 200 μl of wash buffer, and incubated with 100 μl of pNPP (Sigma-Aldrich, St. Louis, MO) for 30 min, and the absorbance was determined at 405 nm. For the time course experiment, 0.1 to 3 μM pUL89-C was used, and the reactions were stopped at the times indicated. The percent remaining substrate was calculated by comparing the absorbance reading for the reaction samples to that of control samples, where no cleavage occurs. To study inhibitor preincubation effectiveness in the absence of Mn²⁺, pUL89-C was preincubated with test compounds in reaction buffer without MnCl₂ for 15 min. MnCl₂ and substrate DNA were added to the reaction system, and the mixture was incubated for 1 h at 37°C and then treated as described above. For the analysis of substrate K_m values, the standard pUL89-C reaction was carried out by using increasing substrate concentrations. The K_m was calculated by using nonlinear Michaelis-Menten fitting of activity as a function of the substrate concentration by using GraphPad Prism software.