Cloning of the Human DCXR Gene into a pET28a Expression Vector

Total RNA was isolated from A549 cells using the TRIzol reagent (Thermo Fisher Scientific). cDNAs were synthesized using reverse transcription with Superscript II RNase H-RT according to the manufacturer’s instructions (Thermo Fisher Scientific). The full length DCXR gene was amplified by PCR using Pfu Easy A polymerase (Agilent, Santa Clara, CA) with the primer pairs hDCXR-F ccgcgcggcagccatatggagctgttcctc and hDCXR-R cgaattcggatccttatcagcaggccca. Forward primers (hDCXR-F) contain an NdeI restriction site and 15 nucleotides at the 5′-end of DCXR, and reverse primers (hDCXR-R) contain a BamHI restriction site and 15 nucleotides at the 3′-end of DCXR, according to the published human DCXR sequence (accession number: {"type":"entrez-nucleotide","attrs":{"text":"NM_016286.3","term_id":"304571973","term_text":"NM_016286.3"}}NM_016286.3, PubMed). The PCR products were purified using a PCR purification kit (Qiagen, Valencia, CA), cloned into the TA vector pGEM-T (Promega), and transformed into Escherichia coli DH10B cells. The pGEMT-hDCXR was isolated using a plasmid miniprep kit (Qiagen), digested with NdeI and BamHI restriction enzymes, and then subcloned into the NdeI and BamHI sites of pET28a, which carries a hexa-histidine tag coding sequence (Novagen, Madison, WI). Positive clones were selected and verified by sequence analysis (DNA Core facility, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ).