The following lentiviral (LV) and retroviral (RV) vectors were used in this study: LV-pico2-Fluc-mCherry expressing Firefly luciferase and mCherry (FmC), a kind gift from Dr. Andrew Kung (Dana Farber Cancer Institute; Boston, MA); RV-MGRi-GFP-Fluc, RV-MGRi-HSV-TK, and MFGi-GFP as previously described (26) To construct viral IFNβ vectors, the human and mouse IFNβ genes were amplified from human and mouse cDNA of IFNβ (Sino Biological Inc., Beijing, China) by PCR using the forward primer with XhoI site (5’cggcctcgagatgacagtgctggcgccagcctggagcccaacaacctatctcctcctgctgctgct gctgagcatgagctacaacttgcttgga3’) for a secretable variant of human IFNβ, in which endogenous signal sequence was replaced with that of Flt3L, (5’cggcctcgagatgaccaacaagtgtctcctc3’) for human IFN with its own signal sequence and the reverse primer with BamHI site (5’ ggcggatcctcagtttgcgaggtaacctct 3’). Secretable mouse IFNβ was amplified the same way with the forward primer with XhoI site (5’ cggcctcgaggctagcatgacagtgctggcgccagcctggagcccaacaacctatctcctcctgctgctgctgctgagcgaattcatcaactataagcagctccagc 3’), (5’cggcctcgagatgaacaacaggtggatcctc3’) and the reverse primer with BamHI site (5’ ggcggatcctcagttttggaagtttctggtaag 3’). The amplified cDNA of human and mouse IFNβ were cloned into retroviral MFGi-GFP vector with XhoI/BamHI digestion respectively. Lentiviral vector cloning were performed similarly using primers with NheI and XhoI sites and ligating the PCR products into the pLV-CSC-IG bearing IRES-GFP (27).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
 Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.