Lentiviral transduction of MSCs

Oligonucleotide sequences were validated at the RNAi Consortium and were purchased from Sigma. Primer sequences were as follows: IFNγRi: Fwd 5’- CATGAACCCTATCGTATATTG and Rev 5’- CATGAACCCTATCGTATATTG; IDOi: Fwd 5’- ACTGGAACTGCCTCCTATT and Rev 5’- AATGGAACTGCCTCCTATT. After annealing, the respective primer pairs were first cloned into the pSUPER plasmid and subsequently sub-cloned into the pLVTHM vector (Addgene, Cambridge, MA, USA). Viral particles were produced using the Viral Vector Platform at Inbiomed Foundation (http://www.inbiomed.org) and MSCs were transfected at a multiplicity of infection (MOI) of 10 in order to obtain a transduction efficiency of 100%.