Constructs and transfection

Two distinct siRNA sequences specifically targeting human PIPKIγ were: PIPKIγ-siRNA1 (ATCCGCGTCGTGGTCATGAACAACA) and PIPKIγ- siRNA2 (GCGTGGTCAAGATGCACCTCAAGTT). PIPKIγ siRNAs and control siRNA were synthesized at Invitrogen (Stealth RNAi). Mouse PIPKIγ constructs encoding isoform 1 and isoform 2 that are resistant to human PIPKIγ siRNAs were constructed as described previously (6).

For transient transfection of siRNAs, OVCAR-8 and SKOV-3 cells were plated in 6-well culture plates at 4×10⁵ cells/well, and then reversely transfected using Lipofectamine RNAiMAX (Invitrogen) for 48 h before further analyses. For the rescue experiments, SKOV-3 cells were transiently transfected with DNA plasmids using X-tremeGENE 9 (Roche) for 24 h, and then lifted and reversely transfected with siRNAs as described above.