Real-time intracellular calcium imaging.

For acute measurements, as shown in Figure 1, F–H, neurons were cultured in 96-well glass-bottom dishes overnight and then loaded with calcium-sensitive dye using the Fluo-4 NW (no wash) Kit from Thermo Fisher Scientific. The dish was placed in a Cellomics Arrayscan–VTI HCS Reader (Thermo Fisher Scientific) with liquid delivery attachment. Baseline signals were collected over 1 to 2 minutes; then drugs were added, after which images were collected over 80 seconds. At least 54–78 neurons were imaged in each well over this period. The data are presented as averaged intensity of fluo-4 fluorescence.Cloning and expression of M1R. The full-length cDNA of M₁R was amplified using the forward and reverse primers (ATGAACACCTCAGTGCCCCCTGC and TTAGCATTGGCGGGAGGGGGTG, respectively) from total RNA extracted from C57BL/J mouse brain tissue. The M1R-cDNA was subsequently cloned in pEGFP-C1 vector (Promega) at the Xho1 and SacII restriction sites. The pEGFP-M₁R plasmid was transfected into adult primary rat DRG neurons using Amaxa Rat Neuron Nucleofection Reagent (VPG-01003) and cultured as described above. The neurons were harvested 48 hours after transfection, and cell lysates were prepared for Western blot, or neurons were fixed in 2% paraformaldehyde. Western blot was immunoblotted using antibodies to GFP (ab-290, Abcam) and M₁R (AMR-001, Alomone Labs) to detect M₁R-GFP fusion protein.