Luciferase Reporter Assay.

AR A. Ripamonti
EP E. Provasi
ML M. Lorenzo
MS M. De Simone
VR V. Ranzani
SV S. Vangelisti
SC S. Curti
RB R. J. P. Bonnal
LP L. Pignataro
ST S. Torretta
JG J. Geginat
GR G. Rossetti
MP M. Pagani
SA S. Abrignani
request Request a Protocol
ask Ask a question
Favorite

HEKCymR CuO-BCL6 were transfected with two different MIR31HG promoter fragment–luciferase reporter constructs. Fragments I and II containing hsa–miR-31 binding sites as predicted by the Genomatix software were cloned upstream of a luciferase gene in the pGL4.10[luc2] vector (Promega): MIR31HG F1 fragment I, PCR forward AGGTGGACTCCCTCTCCCTTAG; MIR31HGF2 fragment II, PCR forward GCTTGCTTGCCTCAGTTGAAGTC; and MIR31HGR1 all, PCR reverse AGCTGCTCACCAAGCTCCTC. Transfections were performed adding increasing amounts (0, 3, 5, 10, and 30 μg/mL) of cumate (System Biosciences). After 24 h, cells were lysed and Firefly and Renilla luciferase activity was measured with the Dual-Luciferase Reporter Assay System (Promega). Results are presented as the ratio of Firefly to Renilla luciferase activity.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A