Luciferase Reporter Assay.

HEKCymR CuO-BCL6 were transfected with two different MIR31HG promoter fragment–luciferase reporter constructs. Fragments I and II containing hsa–miR-31 binding sites as predicted by the Genomatix software were cloned upstream of a luciferase gene in the pGL4.10[luc2] vector (Promega): MIR31HG F1 fragment I, PCR forward AGGTGGACTCCCTCTCCCTTAG; MIR31HGF2 fragment II, PCR forward GCTTGCTTGCCTCAGTTGAAGTC; and MIR31HGR1 all, PCR reverse AGCTGCTCACCAAGCTCCTC. Transfections were performed adding increasing amounts (0, 3, 5, 10, and 30 μg/mL) of cumate (System Biosciences). After 24 h, cells were lysed and Firefly and Renilla luciferase activity was measured with the Dual-Luciferase Reporter Assay System (Promega). Results are presented as the ratio of Firefly to Renilla luciferase activity.