Improve Research Reproducibility A Bio-protocol resource
- Home
- Protocols
-
Concise Method
Viral RNA extraction and detection
Request a Protocol
Ask a
question
Favorite
Viral RNA was extracted from 140 μl of serum, urine and saliva samples, respectively, by using QIAamp Viral RNA kit (QIAGEN, Germany) according to manufacturer’s instruction. ZIKV RNA was determined by using real time RT-PCR on an ABI 7500 Fast Instrument. The primer set used to detect viral RNA was: forward primer, 5’-GTGACGCCACCATGAGCTATGA-3’; reverse primer, 5’- TGATGGCAGGTTCCGTACACAAC-3’; and probe, 5’- /FAM/CCAAGTTGACGTCGTGTTGCACCAGCA/BHQ1/3’.
Copyright and License information: ©2017 Li et al
This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question0 Q&A
