Quantification of Bifidobacterium by qPCR Assay.

Fecal samples were collected 4 d after oral administration of Bifidobacterium species. Bacterial DNA was isolated with the Qiagen DNA Stool Mini Kit following the manufacturer’s instructions. Taqman-targeted qPCR was applied using primers and probes specific for Bifidobacterium: Bifid forward (CGGGTGAGTAATGCGTGACC), Bifid reverse (TGATAGGACGCGACCCCA), and probe (6FAM-CTCCTGGAAACGGGTG). The relative abundance of Bifidobacterium was normalized by primers and probe targeting all bacteria: all bacteria forward (CGGTGAATACGTTCCCGG), all bacteria reverse (TACGGCTACCTTGTTACGACTT), and probe (6FAM-CTTGTACACACCGCCCGTC).