Genotyping

YT Yoko Tajima
KI Keiichi Ito
AU Ayumi Umino
AW Adam C. Wilkinson
HN Hiromitsu Nakauchi
SY Satoshi Yamazaki
request Request a Protocol
ask Ask a question
Favorite

Genomic DNA was extracted from ES cells or the tip of mouse-tail. For screening of ES cells, samples were resuspended in 750 μl Lysis buffer (1 M Tris-HCl/5 M NaCl/0.5 M EDTA/10% SDS/H2O) and incubated with Proteinase K 15 μl for 30 minutes at 55 °C, before incubation with 10 μl RNaseA (10 mg/ml) for 30 minutes at 37 °C. Samples were then mixed with 750 μl phenol/chloroform and centrifuged for 30 minutes at room temperature. The supernatant were again mixed with the same volume and centrifuged. Genomic DNA were purified from its supernatant by ethanol precipitation. PCR was undertaken using HS Ex-Taq (Takara), using 30 cycles of 98 °C for 10 seconds and 68 °C for 60 seconds.

The tip of mouse-tail were boiled with 180 μl of 50 mM NaCl for 15 minutes at 95 °C. The samples were neutralized with 20 μl of 1 M Tris-HCL (pH 7.0) and centrifuged 12,000 × g for 10 minutes. We used its supernatant as PCR template. PCR was undertaken as above but with 35 cycles of 98 °C for 10 seconds and 68 °C for 24 seconds. The following primers were used. K7-EGFP Fwd: gaagcctgctgattcctgac/Rvs: aagtcgtgctgcttcatgtg. K18-tdTomato Fwd: atcaacggaacaaaggatcg; Rvs: ggggaacttcctgactaggg. ES cell K7-TVA Fwd: ggcataggcatgggagtaga; Rvs: caccagctcacagcaaaaga. ES cell Evi-1-TVA Fwd: ctcgtcctgcagttcattca; Rvs: attcagggattttgctgcac. Tail K7-TVA Fwd: gttccctgggtaggggagt; Rvs: cgctctgttccctgtgagta; tcaccgcatgttagcagact. Tail Evi1-TVA Fwd: aaggggaaagagcgctacac; Rvs: cgatgaaattgcggatctct; Rvs: gttcaaatcccagcaaccac.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A