Double-gRNA CRISPR/Cas9 system.

To generate guide RNAs (gRNAs) to disrupt specific CDPK genes, we modified the previously reported CRISPR Cas9-gRNA plasmid (pSAG1::Cas9-U6::sgUPRT plasmid; Addgene plasmid 54467) (30). The single gRNA in this plasmid was replaced by a short oligonucleotide matching each targeted gene (see Table S2 in the supplemental material) using Q5 DNA site-directed mutagenesis (NEB) with a common reverse primer (5′AACTTGACATCCCCATTTAC3′). CDPK-specific CRISPR-Cas9-gRNA plasmids (Table S2) were sequenced to confirm the correct sequence of the gRNA. To generate clean knockouts in T. gondii, a double-gRNA CRISPR/Cas9 system was designed in which the first gRNA sequence (gRNA1) was placed close to the start codon with the second gRNA (gRNA2) near the stop codon (Table S2) of the same gene. To express two gRNAs from a single plasmid, the gRNA2 expression cassette (U6 promoter-gRNA2-RNA scaffold-TTTT) was amplified using a common set of primers called 2nd gRNA F (F stands for forward) (5′CGAATTGGGTACCCAAGTAAGCAGAAGCACGCTG3′) and 2nd gRNA R (R stands for reverse) (5′TCGACCTCGAGAATTAACCCTCACTAAAGG3′) and cloned into the pCAS9-gRNA1 plasmid using restriction sites KpnI and XhoI. A similar strategy was used to generate a series of pCas9-gRNA1-2 plasmids that were specific for each CDPK gene (Table S2).

A plasmid named pLoxP-DHFR-mCherry containing a pyrimethamine resistance cassette (i.e., LoxP-DHFR 5′UTR-DHFR-mCherry-LoxP-DHFR 3′UTR) (Addgene plasmid 70147) was constructed using Gibson Assembly (New England BioLabs) to combine three PCR amplicons that were amplified using Q5 high-fidelity DNA polymerase (New England BioLabs) with primer set 1, 2, and 3 (see Table S3 in the supplemental material), and a LoxP-DHFR 3′ untranslated region (3′UTR) fragment (set 4) was further cloned to replace the surface antigen 1 (SAG1) 3′UTR. This plasmid was used as a PCR template to generate amplicons containing the DHFR resistance cassette flanked by short homology regions (homology region 1 [HR1] and HR2) to specific CDPK genes that were targeted for disruption by CRISPR/Cas9. HR1 was designed to match the sequence upstream of the Cas9-gRNA1 cleavage site, and HR2 was designed to match the sequence downstream of the Cas9-gRNA2 cleavage site, for each specific CDPK gene (Table S4).