Cloning of plasmid library

The pGL4.23-SCP1-ccdB vector was linearized by double digestion with SphI-HF (NEB, R3182) and NdeI (NEB, R0111), and purified through electrophoresis and gel extraction. The captured DNA was cloned into the vector by mixing the DNA and linearized vector at a 5:1 ratio in 16 Gibson assembly reactions (NEB, E2611), each 20 μL. After purification, half of the assembled products were transformed into DH10B electrocompetent bacteria (Life Technologies, C6400-03) by electroporation using the default bacteria transformation setting of the electroporator (Biorad). After 1-h recovery at 37 °C in SOC, electroporated bacteria were split and plated to 80 LB plates supplemented with 100 μg/mL of ampicilin (Sigma-Aldrich, A9518) and grown overnight at 32 °C. Gradient dilute aliquots of the transformation were plated to estimate the size of the cloned library. The colonies were harvested by pipetting 10 mL of LB onto each plate and scraping the colonies off with a cell spreader. The plasmid library was then extracted using a Qiagen Plasmid Plus Mega Kit (Qiagen, 12981) and diluted to 1 μg/μL for all the following transfections.

To determine the sequences of the inserted DNA fragments, 1 ng plasmid library was amplified with PCR using primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (universal primer) and CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTG (Illumina index 7 primer). The PCR products were purified using 0.8 × Agencourt AMPureXP DNA beads, quantified with an Agilent DNA1000 Chip (Agilent, 5067-1504), and then sequenced on a HiSeq 2500 (Illumina) with 250-bp paired-end sequencing.