RNA extraction and reverse transcriptase PCR

RNA from pistils (25 pistils, 2 dae), inflorescences, and ovules (extracted from 30 pistils, 2 dae) was extracted using the Trizol reagent (Invitrogen) according to the manufacturer's recommendations. Pistil and inflorescence cDNA was reverse transcribed using Oligo-dT primers and Superscript II reverse transcriptase from Invitrogen. Ovule cDNA was amplified using the Ovation Pico SL WTA system V2 from Nugen.

Reverse transcriptase PCR (RT–PCR) of ARU was done using primers 5′- CAATGTGCTTGTTCGAGTG -3′ and 5′- ATCCAGTCTTCCAGTTATCCA -3′. For quantitative RT and digital droplet PCR of ARU in A. thaliana accessions, the primers 5′- GTTTGTTACCAATGTGCTTGTTCG -3′ and 5′- TCCATATCCAGTCTTCCAGTTATCC -3′ were used and expression levels were normalized against UBIQUITIN C (UBC9, primers: 5′- ATGCTTGGAGTCCTGCTTGG -3′ and 5′- TGCCATTGAATTGAACCCTCTC -3′). For digital droplet PCR on ovule cDNA, the UBC9 assay was performed as an EvaGreen assay, whereas ARU transcripts were detected using a gene-specific probe (5′-FAM- TACTGCACAAAGGTTG -MGB-3′). The samples were analysed with the QX200 system from Bio-Rad.