Genotyping and quantitative RT‐PCR

After reproduction of B6.Cg‐Tg(NPHS2‐Trpc6) F419Walz/J transgenic mice, genotyping of 2‐week‐old littermates was performed, applying a REDExtract‐N‐Amp Tissue PCR Kit (Sigma), a Trpc6 exon 8 forward primer 5′‐gacactgttctgggctatct and a Trpc6 3′ UTR reverse primer 5′‐cagtgtgatggagctcga as reported (Krall et al., 2010). As an internal control, the endogenous Trpc6 gene was amplified, using a Trpc6 intron 8 reverse primer 5′‐cccattttcctctccccaaa. Amplicons were detected in gel electrophoresis as 830 bp product (transgene) and 530 bp (endogenous TRPC6) bands respectively.

To quantify the TRPC6 transcript abundance, total RNA was isolated from primary podocytes and PASMC with a TRIzol reagent (VWR Life Science, Erlangen, Germany). First‐strand cDNA was synthesized from RNA templates with a RevertAid first‐strand cDNA synthesis kit (Thermo Fisher Scientific, Darmstadt, Germany) and random hexamer primers, following the manufacturer's instructions. Finally, cDNA was applied directly as template in real‐time PCR using DyNAmo ColorFlash SYGR Green qPCR Kit and a Piko Real 24 thermocycler (Thermo Fisher Scientific). Primers for detecting native TRPC6 and smooth muscle α‐actin transcripts were independently designed for rat and mouse TRPC6 proteins. For quantitative RT‐PCR analysis of podocin expression, common mouse/rat primers were used. Transgenic TRPC6 RNA was detected with a Jackson Laboratory genotyping primer and a reverse hemagglutinin (HA) tag primer. PCR was performed with a three‐step protocol (7 min at 95°C; 45 cycles of 15 s at 95°C, 20 s at 56/63/66°C and 30 s at 72°C; and final extension of 2 min at 72°). Results were normalized to 18s RNA, using the ∆C_T method (ratio reference/target = 2 ^C _T ^{(reference) − C} _T ^(target)). All applied primers are listed in Supporting Information Table S1.