2.7. Reverse transcription and real‐time PCR (qPCR)

Reverse transcription (RT) was performed using 1 × PCR buffer II, 5 mM MgCl₂, 1 mM dNTPs, 20 U RNase inhibitor, 50 U MuLV reverse transcriptase and 2.5 μM random hexamers from Applied Biosystems (Life Technologies) with 50 ng of total RNA for 5 min at 25 °C followed by 45 min at 42 °C.

Quantitative real‐time PCR was performed using the LightCycler480 (Roche Diagnostics) in 96 well format with a 10 μl reaction volume. Vector DNA and cDNA samples from RT‐reactions generated in in vitro experiments (luciferase gene transfer) were quantified using the GoTaq Master Mix (Promega, Madison, WI) using the primers luc fw 5′‐gggctcactgagactacatc‐3′ and luc rev 5′‐gtagccatccatccttgtc‐3′.

To quantify vector DNA and cDNA from RT‐reactions from in vivo experiments of hTNFα gene transfer the LightCycler FastStart DNA Master HybProbe Kit (Roche Applied Science, Mannheim, Germany) with the primer sequences hTNF‐α fw 5′‐ctctggcccaggcagtcaga‐3′, hTNF‐α rev 5′‐tcggcaaagtcgagatagtc‐3′ and probe sequences hTNFα FL 5′‐gcattggcccggcggttc‐3′ and hTNFα LC 5′‐ccactggagctgcccctcagct‐3′ was used. All primer and probes were synthesized by Tib Molbiol.

For quantification of hTNFα expression, the mRNA was normalized to G6PDH (Roche) levels. PCR conditions were 95 °C 2 min (GoTaq) 10 min (HybProbe), 95 °C 10s, 61 °C (Luc) 62 °C (TNF‐α) 20 s, 72 °C 10 s for 45 cycles. Prior to quantification of vector DNA, a restriction digest using Fast Digest EcoRI (Fermentas, St. Leon‐Rot, Deutschland) for pCMV‐Luc and Fast Digest KpnI/SacI (Fermentas) for pMok and MIDGE‐based vectors was performed to release the transgenes for detection.