Improve Research Reproducibility A Bio-protocol resource
- Home
- Protocols
-
Request a Protocol
Ask a
question
Favorite
TALENs were designed and assembled as described29. The genomic locus of human CD47 (NC_000003.12) was scanned for putative TALEN binding pairs. Exon 2 was ultimately selected for targeting and the TALEN pairs TGTCGTCATTCCATGCTTTG and TATACTTCAGTAGTGTTTTG were respectively cloned into the pTALEN backbone.
Copyright and License information: ©2017 PMC Copyright notice
Reprints and permissions information is available at www.nature.com/reprints.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question0 Q&A
