Improve Research Reproducibility A Bio-protocol resource
- Home
- Protocols
-
Concise Method
Sequence analysis of the gene editing by CRISPR/Cas9
Request a Protocol
Ask a
question
Favorite
Genomic DNA extracted from CEM T cell clone 1 by PCR with three primer sets, which were designed homologous to cell sequences flanking the integration site on the genome. For sequence analysis, the PCR product amplified with primer set 1 (sense: GTCCCAACTCATTTGGATTAC, antisense: GAAAAGGAAAGAGTCGTGTG) was cloned into pBluescript KS(-) vector and sequenced with M13 forward primer.
Copyright and License information: ©2015 Yan et al
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are properly credited.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question0 Q&A
