Sandwich ELISA

Analysis of conditioned media from cultured HMECs from three donors at P2 (pre-stasis), P4 (stasis), and P8 (post-stasis) was initially performed using the Raybiotech Quantibody Human Kiloplex array, which detects 1,000 human biomarkers, as a service by the manufacturer. We followed up on interesting candidates using sandwich ELISA kits from Raybiotech to detect TGF-β, Activin A, Serpin E1, Wnt4, R-Spondin2, DKK1, and Follistatin according to the manufacturer’s protocols. For these assays, conditioned media were generated by culturing 300,000 cells per well in a six-well plate in 1 mL of serum-free basal media for 24 h. Each analyte was measured in eight biological and three technical replicates. The concentration of each factor in the conditioned media was extrapolated from the corresponding standard curves.

Immunofluorescence: Cells were cultured on four-well glass chamber slides (Millipore). The cells were fixed with 4% paraformaldehyde in PBS for 15 minutes at room temperature and permeabilized for 10 minutes in PBS containing 0.25% Triton X-100. Non-specific binding was blocked with 10% donkey serum (Jackson Immunoresearch), 0.3M glycine, and 0.1% Tween-20 in PBS for one hour. Primary antibodies were applied overnight in 1% donkey serum and 0.1% Tween-20 in PBS. The following primary antibodies were used: p16 (E6H4, Roche) mouse mAb (pre-diluted), p21 Waf1/Cip1 (12D1, Cell Signaling Technologies) rabbit mAb (1:400), p63-α (D2K8X, Cell Signaling Technologies) XP rabbit mAb (1:200), α-tubulin (DM1A, Sigma-Aldrich) mouse mAb (1:4000), MUC1 (HMFG2, Abcam) mouse mAb (1:200), Lamin A + Lamin C (EPR4100, Abcam) rabbit mAb (1:500), cytokeratin 19 (EPR1579Y, Abcam), rabbit mAb (1:400), and cytokeratin 14 (LL002, Abcam) rabbit mAb (1:200). Alexa Fluor 555-conjugated phalloidin (1:400) was used to stain F-actin (Thermo Fisher Scientific). Secondary donkey anti-mouse 488 and anti-rabbit 555 antibodies (diluted 1:500) were added to 1% donkey serum and 0.1% Tween-20 in PBS for one hour. DAPI (0.2 μg/mL in PBS) was added for five minutes at room temperature. The slides were washed three times for three minutes between each step in PBS containing 0.1% Tween-20. The coverslips were mounted with Vectashield HardSet Mounting Medium (Vector Laboratories). Images were acquired using a Leica SP8 laser scanning confocal microscope (only Tubulin/F-actin and Lamin A/C) at a resolution of 1,024 × 1,024, processed using LASX software (Leica Microsystems) or a BZ-X800 fluorescence microscope (Keyence), and processed using ImageJ (version 2.14.0/1.54f).

Quantitative Polymerase Chain Reaction (qPCR): Total RNA was isolated from cells and treated with DNase I using the RNeasy Mini Kit (Qiagen). cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Quantitative PCR was performed on a CFX-96 (Bio-Rad Laboratories) thermocycler using 2x SsoFast Master Mix (Bio-Rad Laboratories) and analyzed using the standard curve method. A standard curve was prepared using the cDNA produced from Human Reference RNA (Agilent Technologies). Pre-made TaqMan Gene Expression Assays (Thermo Fisher Scientific) were used: ZEB1: Hs00232783_m1, SNAI1: Hs00195591_m1, SNAI2: Hs00161904_m1, TWIST1: Hs01675818_s1, CDH3: Hs00999915_m1, VIM: Hs00958111_m1, CDH1: Hs01023895_m1, CDH2: Hs00983056_m1, CDKN1A: Hs00355782_m1, MMP-2: Hs01548727_m1, FN1: Hs01549976_m1, CHRDL2: Hs01060234_m1, GREM1: Hs01879841_s1, and WNT5a: Hs00998537_m1. Custom primer-probe sets were used for GUSB: Forward Primer: CTCATTTGGAATTTTGCCGATT, Reverse Primer: CCGAGGAAGATCCCCTTTTTA, and Probe: FAM-TGAACAGTCACCGACGAGAGTGCTGGTA-TAM and CDKN2A (specific for p16^INK4A and not p15^ARF): Forward Primer: CCAACGCACCGAATAGTTACG, Reverse Primer: GAGTGGCGGAGCTGCT, and Probe: FAM-CCGATCCAGGTCATGATG-TAM produced by Integrated DNA Technologies. GUSB expression was used to normalize variance in the input cDNA.

Western Blotting: Cells were washed with PBS and lysed using radioimmunoprecipitation assay (RIPA) buffer containing the HALT protease and phosphatase inhibitor cocktail. For each sample, a cell extract (corresponding to 50 μg of protein as determined by a Micro BCA Protein Assay Kit) was prepared in NuPAGE LDS Sample Buffer (4X) with Reducing Agent (10X), heated at 95°C for 15 minutes, and electrophoresed in each lane of a NuPAGE 4–12% Bis-Tris gel along with a BenchMark Pre-stained Protein Ladder (Thermo Fisher Scientific). Proteins were transferred onto a nitrocellulose membrane (Biorad) overnight at 4°C at 36 mV. The membrane was washed in TBS-T (0.05 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.05% Tween-20), blocked for one hour at room temperature in blotto (5% nonfat dry milk in TBS-T), incubated with primary antibodies overnight at 4°C, washed in TBS-T, incubated with goat anti-rabbit horseradish peroxidase conjugate secondary antibody (Jackson Immunoresearch) 1:5000 in Blotto for one hour, washed in TBS-T, and developed with ECL Western Blotting Substrate. Chemiluminescent signals were detected by exposing the CL-XPosure Film to the membranes or using the KwikQuant Digital Western Blot Detection System. Primary antibodies used at a 1:1000 dilution from Cell Signaling Technologies were Slug (C19G7) rabbit mAb, ZEB1 (D80D3) rabbit mAb, Slug (C19G7) rabbit mAb, E-cadherin (24E10) rabbit mAb, N-cadherin (D4R1H) XP rabbit mAb, Vimentin (D21H3) XP rabbit mAb, RAS rabbit pAb, EZH2 (D2C9) XP rabbit mAb, Histone H3 (D1H2) XP rabbit mAb, and β-Actin (13E5) rabbit mAb; and from Active Motif Histone H3K27me3 (MABI 0323) mouse mAb. Full images of the western blots are shown in Supplemental Figs. S4 and S5.

Multiplex Immunohistochemistry: Sections (5 μm thick) were cut from FFPE tissue blocks and placed on positively charged Superfrost Plus microscopy slides. Slides were baked at 60°C overnight, deparaffinized in xylene, and rehydrated in graded ethanol (100%, 100%, 95%, 85%, and 70%) in distilled H O. Endogenous peroxidases were quenched with 3% H O (Sigma-Aldrich) diluted in phosphate-buffered saline (PBS). Heat-induced antigen retrieval was performed in citrate buffer pH 6.0 (Sigma-Aldrich) at 95°C for 15 minutes. Non-specific antibody binding was blocked using a Background Sniper (Biocare Medical). The tissue sections were incubated for one hour at room temperature (RT) with each primary antibody in 1% BSA and 30 minutes in pre-diluted MACH 2 conjugated anti-mouse or anti-rabbit secondary antibodies (Biocare Medical). The slides were washed in TNT buffer (0.1 M TRIS-HCL pH 7.5, 0.15 M NaCl, and 0.05% Tween-20) following blocking and three times for five minutes each after applying both primary and secondary antibodies. The signal was developed using a Tyramide Signal Amplification (TSA) solution (Akoya): FITC (two minutes), Cy3 (three minutes), or Cy5 (seven minutes). The antibody complex was removed by heating at 95°C in citrate buffer pH 6.0 for five minutes to allow for multiplex staining. Nuclei were counterstained with 3 μM DAPI in PBS for five minutes, washed in distilled H O, and mounted using Vectashield HardSet Mounting Medium (Vector Laboratories). The primary antibodies used from Cell Signaling Technologies were Slug (C19G7) rabbit mAb (1:1000), Snail (C15D3) rabbit mAb (1:1000), p63-α (D2K8X) XP rabbit mAb (1:2000), and vimentin (D21H3) rabbit mAb (1:5000); from AbCam Cytokeratin 5 (SP27) rabbit mAb (1:4000), Lamin A + Lamin C (EPR4100) rabbit mAb (1:10000), Cytokeratin 13 (EPR3671) rabbit mAb (1:2000), Ki67 (SP6) rabbit mAb (1:6000), and Cytokeratin 14 (SP53) rabbit mAb (1:3000).The slides were imaged using a BZ-X800 analyzer. Images were prepared for analysis using the ImageJ software (version 2.14.0/1.54f). Analysis was performed using the Qupath software (v0.5.0)[45]. Using the pre-trained models, nuclear segmentation was performed using StarDist[46], normalizePercentiles = 1, 99, threshold = 0.5, pixel size = 0.5, and cell expansion = 5.0. Individual classifiers were trained for each marker and combined to create a composite classifier for scoring the cells within the annotated regions.