Lentiviral transduction

Sestrin knockdown in human CD8⁺ T cells was achieved using a lentiviral transduction system as described previously⁹.

The pHIV1-SIREN-GFP system used for knockdown of gene expression possesses a U6-shRNA cassette to drive shRNA expression and a GFP reporter gene that is controlled by a PGK promoter5. The following siRNA sequences were used for gene knockdowns: CCTAAGGTTAAGTCGCCCTCG (shCTRL), CCAGGACCAATGGTAGACAAA (shSesn1), CCGAAGAATGTACAACCTCTT (shSesn2) and CAGTTCTCTAGTGTCAAAGTT (shSesn3). VSV-g pseudotyped lentiviral particles were produced, concentrated and titrated in HEK293 cells as described⁹.

Cells were cultured in RPMI-1640 medium supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 mg/ml streptomycin, 50 μg/ml gentamicin, 2 mM L-glutamine (all from Invitrogen) and 0.5 ng/ml anti-mycoplasma (Bio-Rad) at 37 °C in a humidified 5% CO₂ incubator. Purified human highly differentiated CD28⁻CD8⁺ T cells were activated in the presence of plate-bound anti-CD3 (purified OKT3, 0.5 μg/ml) plus rhIL-2 (R&D Systems, 10 ng/ml), and then transduced with pHIV1-Siren lentiviral particles (multiplicity of infection (MOI) = 10) 72 h after activation.