Plasmids and transfection.

Full-length wild-type PAK4 DNA was amplified by PCR using a human complementary DNA library and primers including 5′ AATTGGATCCATGTTTGGGAAGAGGAAGAAGC-3′ and 5′- AATTGCGGCCGCTTACTTGTCATCGTCGTCCTTGTAGTCTCTGGTGCGGTTCTGGCGCA-3′, and subcloned into pcDNA3 vector at the BamHI/NotI sites. PAK4^K350M DNA was generated by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit; New England Biolabs) using wild-type PAK4 as a template and primers including 5′-GGTGGCCGTCATGATGATGGACCTGCG-3′ and 5′- AGCTTGCCCGAGCTGCGC-3′. Plasmid construction was verified by restriction digestion and DNA sequencing. Cells were transfected with plasmids using Lipofectamine (Invitrogen; L3000001) in serum-free Opti-MEM medium (Gibco; 31985-070).