Reporter gene assays

Plasmids: The Gal4-fusion receptor plasmids pFA-CMV-hNur77-LBD, pFA-CMV-hNURR1-LBD, and pFA-CMV-hNOR1-LBD coding for the hinge region and LBD of the canonical isoforms of the human nuclear receptors Nur77 (uniprot entry: hNUR77–{"type":"entrez-protein","attrs":{"text":"P22736","term_id":"127819","term_text":"P22736"}}P22736, residues 358–598), Nurr1 (uniprot entry: hNURR1–{"type":"entrez-protein","attrs":{"text":"P43354","term_id":"1171750","term_text":"P43354"}}P43354, residues 360–598), and NOR1 (isoform alpha; uniprot entry: hNOR1–Q92570-1, residues 393–626) were constructed by integrating cDNA fragments obtained from PCR amplification using natural cDNA (Nur77: GenBank entry: {"type":"entrez-nucleotide","attrs":{"text":"BC016147.1","term_id":"16359382","term_text":"BC016147.1"}}BC016147.1, purchased as I.M.A.G.E. cDNA clone from Source BioScience, Nottingham, UK; Nurr1: GenBank entry: {"type":"entrez-nucleotide","attrs":{"text":"BC009288.2","term_id":"33874453","term_text":"BC009288.2"}}BC009288.2, purchased as I.M.A.G.E. cDNA clone from Source BioSience) or the pcDNA3.1 plasmid OHu22293D (NOR1; GenScript, USA; NCBI ref. {"type":"entrez-nucleotide","attrs":{"text":"NM_173200.2","term_id":"331999988","term_text":"NM_173200.2"}}NM_173200.2) as template between the BamHI cleavage site of the pFA-CMV vector (Stratagene, La Jolla, CA, USA) and an afore inserted KpnI cleavage site. Frame and sequence of the fusion plasmids were verified by sequencing. The Gal4-fusion receptor plasmids used for selectivity profiling were pFA-CMV-hPPARα-LBD, pFA-CMV-hPPARγ-LBD, pFA-CMV-hPPARδ-LBD, pFA-CMV-hRXRα-LBD, and pFA-CMV-hRARα-LBD coding for the hinge region and ligand-binding domain of the canonical isoform of the respective nuclear receptor have been reported previously^27–29. pFR-Luc (Stratagene) was used as reporter plasmid and pRL-SV40 (Promega, Madison, WI, USA) for normalization of transfection efficiency and test compound toxicity. The Gal4-VP16¹² expressed from plasmid pECE-SV40-Gal4-VP16³⁰ (Addgene, entry 71728, Watertown, MA, USA) was used as ligand-independent transcriptional inducer for control experiments. The reporter plasmid pFR-Luc (Stratagene) used for the Gal4-hybrid assays contains a section between 176 to 83 base pairs upstream of the start codon of the firefly CDS that encompasses five copies of the Gal4 response element. To enable transactivation assays based on full-length NRs, this section was replaced with the human Nurr1 response elements DR5 (pFR-Luc-DR5; TGATAGGTTCACCGAAAGGTCA), NBRE NL3 (pFR-Luc-NBRE; TGATATCGAAAACAAAAGGTCA), or NurRE (from proopiomelanocortin (POMC); pFR-Luc-NurRE; TGATATTTACCTCCAAATGCCA), respectively. The human nuclear receptors Nurr1 (pcDNA3.1-hNurr1-NE; #102363, Addgene, Cambridge, MA, USA) and, for DR5, RXRα (pSG5-hRXR³¹) were overexpressed. Assay procedure: HEK293T cells (German Collection of Microorganisms and Cell Cultures (DSMZ), Braunschweig, Germany) were grown in DMEM high glucose, supplemented with 10% FCS, sodium pyruvate (1 mM), penicillin (100 U/mL), and streptomycin (100 µg/mL) at 37 °C and 5% CO₂. The day before transfection, HEK293T cells were seeded in 96-well plates (3 × 10⁴ cells/well). Before transfection, medium was changed to Opti-MEM without supplements. Transient transfection was performed using Lipofectamine LTX reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol with the corresponding plasmid mixture. For Gal4-hybrid assays, the plasmid mixtures comprised the respective Gal4-fusion nuclear receptor plasmid (pFA-CMV-NR-LBD), pFR-Luc, and pRL-SV40. For assays on full-length human Nurr1, the plasmid mixtures were pcDNA3.1-hNurr1-NE/pFR-Luc-NBRE/pRL-SV40 (NBRE), pcDNA3.1-hNurr1-NE/pFR-Luc-NurRE/pRL-SV40 (NurRE), and pcDNA3.1-hNurr1-NE/pSG5-RXR/pFR-Luc-DR5/pRL-SV40 (DR5). Five hours after transfection, medium was changed to Opti-MEM supplemented with penicillin (100 U/mL) and streptomycin (100 µg/mL), now additionally containing 0.1% DMSO and the respective test compound or 0.1% DMSO alone as untreated control. Each concentration was tested in duplicates and each experiment was performed independently at least three times. Following overnight (12–14 h) incubation with the test compounds, cells were assayed for luciferase activity using Dual-Glo™ Luciferase Assay System (Promega) according to the manufacturer’s protocol. Luminescence was measured with a Spark 10 M luminometer (Tecan Group Ltd., Männedorf, Switzerland). Normalization of transfection efficiency and cell growth was done by division of firefly luciferase data by renilla luciferase data and multiplying the value by 1000 resulting in relative light units (RLU). Fold activation was obtained by dividing the mean RLU of a test compound at a respective concentration by the mean RLU of untreated control. Max. relative activation refers to fold reporter activation of a test compound divided by the fold activation of the respective reference agonist (PPARα: GW7647; PPARγ: pioglitazone/rosiglitazone²⁹; PPARδ: L165,041; RXRα: bexarotene; RARα: tretinoin; all at a concentration of 1 µM; Nurr1: amodiaquine (100 µM)). All hybrid assays were validated with the above mentioned reference agonists which yielded EC₅₀ values in agreement with the literature.