2.6. Minigene plasmids construct

ML MeiYi Li
MY Minna Yin
LY Li Yang
ZC Zhiheng Chen
PD Peng Du
LS Ling Sun
JC Juan Chen
request Request a Protocol
ask Ask a question
Favorite

GJB1 wild type (WT) and mutant type (MUT) gene sequences were amplified from peripheral blood leukocytes genomic DNA of IV‐7 and IV‐4, respectively. The primers for constructing pcMINI‐C‐GJB1‐WT/MUT plasmids were as follows: forward primer(pcMINI‐C‐GJB1‐KpnI‐F): 5′‐ggtaGGTACCttggatgaaagcgaagaagg‐3′ and reverse primer(pcMINI‐C‐GJB1‐BamHI‐R): 5′‐TAGTGGATCCtcagcaggccgagcagcggt‐3′. As for pcDNA3.1‐GJB1‐WT/MUT plasmids, forward primer(pcDNA3.1‐GJB1‐KpnI‐F): 5′‐GCTTGGTACCATGGGGCGGTGATGAATTGGGAC‐3′ and reverse primer(pcDNA3.1‐GJB1‐BamHI‐R): 5′‐TAGTGGATCCtcagcaggccgagcagcggt‐3′ were used. Amplification products were subsequently cloned into pcMINI‐C or pcDNA3.1 expression vector by double digestion with KpnI and BamHI enzyme (New England Biolabs). Recombinant plasmids were purified with the Endo‐Free Plasmid Midi Kit (Omega Bio‐Tek) and confirmed by Sanger sequencing.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A